Protein Synthesis: Alternative Codon Code

Best of luck! :)

CTCCAGTACTAAGGCTTGAACGCAGCCAGTGCTATGTCAATCTCAGT

Thomas Malthus as an Historical Influence on Charles Darwin

            Thomas Malthus was an English economist who was and is still known for his studies, writings and theories about overpopulation and population growth in general. He theorized that, if unchecked, humans would continue overpopulating the earth until all of the world’s resources were used up, leaving people with no way of feeding themselves. According to the University of California Museum of Paleontology (UCMP), “[Malthus] blamed this decline [of living conditions] on three elements: The overproduction of young; the inability of resources to keep up with the rising human population; and the irresponsibility of the lower classes” (UCMP 1995). The first two causes were reasonable and potentially could have been falsifiable, and even Charles Darwin hadn’t broached this concept.

            After reading Malthus’s Essay on the Principle of Population (1798) Darwin notes in his autobiography, “It at once struck me that under these circumstances favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The results of this would be the formation of a new species. Here, then I had at last got a theory by which to work” (UCMP 1995). Malthus’s essay gave Darwin a new mode of thinking about his own theory, and without it, The Origin of Species would not have been as successful a body of work. Prior to reading it, “Darwin had thought that living things reproduced just enough individuals to keep populations stable,” but through Malthus realized that organisms grow exponentially to encourage and support the survival of their species; the strongest and best adapted survive, while the weakest perish and their genes do not get passed on (Darwin and Malthus 2001).

            Darwin’s realization relates directly to the points: 1) All organisms have the potential of reproducing exponentially, and 2) Resources are limited. Without these two points, Darwin’s theory would really have no basis on which to stand. By understanding that overpopulation is possible for every living being, he then understood that a lack of resources creates competition between offspring and between species themselves; so whichever creatures were best suited for their environment through physical adaptations over time would be more likely to survive. Without Malthus’s essay on these very topics, even though they were related to economics and the human population, Darwin’s theory would not have been nearly as correct, as the point of overpopulation is fundamental to evolution and natural selection. Darwin was able to build off of Thomas Malthus’s work to create a more accurate representation of how natural selection worked.

            This isn’t to say that Darwin would have been completely unable to do this himself, but it would have taken him much longer. He hadn’t previously thought of overpopulation as a necessary step of evolution, so Malthus’s work greatly influenced Darwin’s course.
            The attitude of the church, however, further limited Darwin at this time, because they, like Malthus, were still under the impression that everything that occurred in the world had some divine intercession behind it. Not only did this limit their breadth of knowledge, it also limited what knowledge could be shared. Although Malthus correctly saw some of the effects of overpopulation, he still believed that famine and poverty were from the will of God to prevent man’s laziness (UCMP 1995), instead of just attributing it to a lack of resources as he had already posed. Every theory at this time was expected to respect divine influence, giving all credit to God instead of trying to find a natural explanation on Earth, so it’s really no wonder why it took Darwin over 20 years to publish On the Origin of Species. Given his family’s position in society, and his level of regard in the scientific community, breaking away from the fairly oppressive beliefs of the church are what hindered his publication. But, to bring this subject full circle, without Malthus’s ideas, the book might never have been finished.

Citations and Resources

BBC News

N.d. Thomas Malthus (1766 – 1834). BBC News. BBC, accessed 17 June 2014. http://www.bbc.co.uk/history/historic_figures/malthus_thomas.shtml.

Darwin and Malthus

2001 WGBH Educational Foundation and Clear Blue Sky Productions, Inc. Evolution by Public Broadcasting Service (PBS), accessed 17 June 2014. http://www.pbs.org/wgbh/evolution/library/02/5/l_025_01.html.

MacRae, Donald Gunn

N.d. Malthusian Theory. Encyclopedia Britannica Online. Encyclopedia Britannica, accessed 17 June 2014.

http://www.britannica.com/EBchecked/topic/360609/Thomas-Robert-Malthus/222944/Malthusian-theory.

University of California Museum of Paleontology

1995 Thomas Malthus (1766-1834). UCMP, accessed 17 June 2014. http://www.ucmp.berkeley.edu/history/malthus.html.