Human Variation in Adaption

In humans, the cold disturbs homeostasis, the equilibrium that the body maintains for normal functioning, by decreasing core body temperature. The human body can survive for a great deal under 98.6˚F, but after a point develops hypothermia and begins to break down normal functions, like the temperature regulation of the hypothalamus.

But in order to live in the varied climates that humans do, we have developed several different adaptations (i.e. short term, facultative, developmental, and cultural adaptations) that allow us to inhabit subnormal temperatures.

Short term adaptations occur to maintain the body's homeostasis on a short-term basis. The response is quick, and the return to the normal trait expression is equally as fast once the stress has been removed. For example, in the extreme cold, humans shiver to produce heat from the muscles, therefore limiting the amount that the body has to do to warm up the periphery of the body, and conserving the heat of the internal body temperature. Also, in the human body blood vessels constrict to preserve the core body heat in a similar way as shivering, so blood flow is reduced to the extremities.

Facultative adaptations are genetic traits not requiring a change in DNA, but rather an alteration of the expression of traits in response to environmental stress. This is different from short term adaptatio
ns because they take longer to return to the normal trait expression. In the same subnormal temperature example, the human body would respond in a facultative adaptation with an increase in metabolism, which is controlled through the hypothalamus. The increase in metabolism would produce extra body heat, therefore warming the core body temperature. However, this adaptation would take much longer than shivering to return to its normal levels.

Developmental adaptations are actual changes in the DNA of an entire population that has been exposed to a particular long-term stress. Evolutionary forces (i.e. natural selection) have produced a phenotypic change, and therefore these adaptations are those an individual is born with and will have throughout their entire life. If a person is part of a population, and their parents and prior ancestors have been as well, particular environmental stresses may cause that individual to be born with shorter limbs and an overall more compact body and higher body mass. The loss of surface area would conserve body heat better, therefore making this person's physical stature, something they were born with, an adaptation.

Related to the increase in the facultative adaptation of metabolism is actually the cultural adaptation of a change in diet. Consuming large quantities of high calorie fatty foods would help those who lived in consistently subnormal temperatures to develop a faster metabolism, warmer their core body temperature.

There are many benefits to studying adaptations across clines, but especially that as we learn about how the human body naturally responds to environmental stresses, we can use this information to advance cultural adaptations that can work alongside the body's natural processes. So for example, in addition to the cultural adaptation of a change in diet, there is also the development of insulation in clothing that works along with the body's natural chemistry to retain just the right amount of body heat to maintain homeostasis. Without studying adaptations across the clines, like the trait of shivering, or that of an increased metabolism, or a naturally compact build, certain technological advances in clothing would be rather pointless. If a clothing designer wanted to create clothes for people in these environments, they would need to know how those people store heat and energy, otherwise the clothes created might release too much heat, and therefore be rendered useless.

However another way that people try to understand adaptations is by applying race to the mix. One might say that because of race, an African male would not be able to live in the arctic regions because his arms and legs are so long, so he's not well suited for the environment. Many people attribute qualities such as long arms and legs to being black, when it's a completely varied number of circumstances that can make an individual tall and have long limbs. And that doesn't necessarily mean that he cannot survive in the subnormal temperatures, just that he will have to cope differently than a person of compact build.

The study of environmental influences on adaptations is a much better way to understand human variation because race won't give any indication of how a person might adapt to an environment. Just because a person is part of a certain culture doesn't mean their body won't react the same way as a person with an Alaskan Indian culture. Culture has nothing to do with how their bodies react and adapt to stress. The traits they inherited from their parents may give them a genetic advantage/disadvantage to living in a certain climate, but that is only noted through the study of environmental influences, of the study of developmental adaptations. To understand how to survive, we have to focus on what we can biologically bring to a situation and then enhance that trait with whatever cultural technologies we can apply to that biological base.

Experimenting with Language and Communication

In the two parts of this experiment, I was asked to first "engage in a conversation for 15 minutes" where I was not allowed to use "any version of a symbolic language (no speaking, writing, or ASL)," and second to spend another "15 minutes communicating without any physical embellishments," basically referring to body language and vocal intonation.

With the first part of the experiment, I found it fairly challenging. In the beginning I wasn't quite sure how to start and how to respond to my partner in conversation. Eventually it became similar to charades with me attempting to act out what I meant, but by the end of the fifteen minutes we had barely gotten through one idea in our conversation, and I had to explain to him what I had been trying to communicate. Our attempt at discussion was rather humorous to the both of us, but that's only because we knew that at the end of the fifteen minutes we would go back to talking to one another. However if we didn't have that opportunity, a simple dialogue would be nearly impossible.

Had we been two different cultures meeting for the first time, we really would only be able to share very simple ideas that we could act out through similarities. For example, if I was trying to explain to someone from another culture that an apple was sour, I could show them an apple, and then make a face as if it were sour, or hold up a lemon and make the same facial expression to show them through associations what I'm trying to say. However, if my culture could speak and the other culture could not, I believe I would be at a disadvantage in communication. Since the other culture would already be accustomed to conversing through body language, they could share ideas much more easily than I could. Since my symbolic language would mean nothing to them, I couldn't use it, and thus I would have to figure out a way to act out my meaning. However since both cultures share body language, that form of communication would still be open, though my speaking culture would be at a disadvantage.

Those in speaking cultures have historically tried to share (force) their symbolic language with (upon) the places to where they travel. In example, the English language was spread to the rest of the world as the British colonizers traveled around the world, even if those native to the area had no interest in learning the language. However, it still must have been much easier for those who had a solid symbolic body language to share their complex ideas with each other, and even with the colonizers, than it was for the colonizers to discuss ideas with them. Most people understand body language, even if they don't understand each other's native tongues.

There are several groups in our culture who have difficulty communicating with spoken language, like those who are deaf, mute, or have other speech or language disorders. Focusing on the first two, individuals who are deaf and/or mute generally learn sign language to communicate with others, which may be American Sign Language (ASL) or the sign language of another culture. Interaction and communication with those who do speak changes because those who speak must learn a new type of symbolic language, though in this case it would become symbolic body language. It would also change dialogue since a person who speaks can often multitask, doing other things while talking to others, but while signing, this same person would have to pay attention to the person their signing with, or else they would miss part of the conversation. It requires a shift in the way the brain works, really. People who speak regularly rely on both their senses of hearing and sight to communicate, since spoken language includes both the use of the voice and the observation of body language, but with those who sign, the shift becomes the complete observation of body language.

In the second part of the experiment, however, we were not to use any type of body language, physical embellishment, or change in intonation for fifteen minutes, and I found this nearly impossible. I'm a very expressive person when I talk, using my hands and facial expressions to express both my ideas and my opinions of ideas. My friends and family think of me as an open book because of it, so I found being unable to use any of my normal body movements extremely unnatural. I basically had to focus on talking and acting like a robot to avoid changing intonation or moving my face. At the longest I was able to do this for two or three minutes, but then my partners in conversation would start laughing because it's just so unnatural to how I normally speak.

Although I tried fairly hard to keep my composure, my partners in conversation found it more amusing to try and make me laugh. And even when we were all being serious, it's just not how conversation works; people need body language to understand one another's thought processes. It's what the idiom "read between the lines" refers to: the ability "(1) to infer something (from something else); to try to understand what is meant by something that is not written explicitly or openly," or "(2) to try to understand someone's real feelings or intentions from what they say or write" (McGraw-Hill Dictionary of American Idioms).

There is so much context that's involved in body language, which is why it's often hard to read someone's intentions, for example, over text messages or the internet, because one can't read their expressions to see exactly how they mean a statement. In my conversation, my partners had to ask me if I was being sarcastic because it was so hard to figure my meaning without expressional cues. Non-speech language is essential to communicate effectively because speech language is completely flat without it. Our words don't take meaning without the emotion behind them, which is revealed through our facial and body expressions, as well as changes in our intonation.

There are those who understand and can speak this symbolic language, but have difficulty reading body language. In my experience, I have a friend who has Asperger's syndrome, which is a pervasive developmental disorder (PDD), and from what he's explained to me and what I've researched myself, I know that it affects one's ability to interact in social situations and how one acts and reacts on an everyday basis. My friend has had no problem developmentally in learning or speaking, but occasionally he has problems with his social skills. Although he's developing in this regard as well, he still has issues like understanding when he's making other people uncomfortable in a conversation, such as bringing up a topic others don't want to talk about, or just taking a topic too far. He also becomes very frustrated because he doesn't understand why other people get upset, which stems from the fact that he just isn't picking up on the physical cues that others give him. It's something we've worked through in our friendship, but is also something that he works through with every new person he meets.

We adapted the ability to read body language from reading other animals in the wild. In primates, for instance, if a smaller gorilla cannot read the body language of the leader (silverback) of the band, he might accidentally irritate the silverback to the point where he would strike the smaller ape. In the wild, I think reading body language is a way to keep oneself alive. For example, early hominids would also have had to protect themselves by observing the body language of larger animals, like carnivorous animals like lions or cheetahs, and the easiest way to keep oneself alive is to notice the difference between when these animals are hunting, or when they're tired and ready to sleep. The ability to note body language is most beneficial for self-preservation.

I can't think of very many circumstances where there might be a benefit to not reading body language, but perhaps if one is in a job interview, one may try to understand the intentions behind the body language of his interviewer. However he doesn't know his interviewer personally, so he might assume that his interviewer is bored or uninterested in what he has to say, which would make him even more nervous, and thus his performance in his interview would be negatively impacted. In that case and cases like it, reading body language should be done with a grain of salt, as in, read the other person's body language, but don't read too much into it because several other factors may be weighing in to the other person's expressions. There are probably several other examples that I'm not thinking of, but reading body language generally helps us to better understand one another by avoiding miscommunication, and helps us to get to know one another's opinions based on their actions and reactions.

The Piltdown Hoax: a Flaw of Man

In the beginning of the twentieth century, scientists in Britain fairly desperately tried to be the first to find a "missing link" between humans and apes in Great Britain not only to win the accolades of being the one to find it, but to also gain the international prestige for Great Britain as being a place that shared links to the origin of mankind, since as of yet they had none.

But in the early 1900s the remains of a skull fossil were found in the county of Sussex, England near a village called Piltdown by a worker who gave it to amateur archaeologist Charles Dawson. This led to a series of finds at the Piltdown site including tools and other prehistoric animals. Dawson, along with noted geologist Sir Arthur Smith Woodward, had spent a considerable amount of time digging through the site to find further evidence of what they deemed the earliest Englishman. Their work seemingly paid off when they found a piece of a jawbone similar to apes, but with human-like teeth that was considered a link to the early skull piece. From these finds, Dawson and Woodward introduced to the scientific community an ancestor to humans that was vastly different from specimens found elsewhere in the world, and boldly said that the origin of man was from Britain, and not France, Germany or Africa.

There were still skeptics, though, especially because of how broken the jawbone was, omitting any connection to the actual skull and having an absence of canine teeth. But a year later disbelief was somewhat subdued when Dawson, Woodward, and another amateur archaeologist, French philosopher and priest Teilhard de Chardin found a canine tooth at Piltdown that almost perfectly matched what they had proposed the size of the tooth would be. And even more amazingly, in 1917 Woodward announced their discovery of a second Piltdown man, turning previous theories on the origin of man upside down, given that it fit nowhere in the path of evolution that previously discovered fossils had already set.

But in 1953, the scientific world was turned upside down once again, when Professor Kenneth Oakley of the British Museum proved that the fossils found at Piltdown were fake. By using the method of relative dating through fluorine analysis, he and his team were able to test the amount of fluorine in the bone samples, intending to prove that the jawbone did not belong to the skull fragment, but also revealing that the bones didn't even belong to the same animal. Not only was the staining applied to the fossils to get them to match, but also the jawbone was that of a female orangutan or chimpanzee whose teeth had been filed down.

The embarrassment from this revelation stemmed from the fact that in its thirst to have such a discovery in its country, many renowned scientists in Great Britain never thought to inquire further about the facts of Piltdown, while the rest of the scientific world already seriously questioned its authenticity. The research of several scientists who studied evolution and had trusted this find implicitly was for naught; they were misled for near fifty years, searching down a path that was a complete dead-end and would get them nowhere.

It seems as though the main fault of Charles Dawson was his fervor to receive academic recognition, which may have been what caused him to falsify most of his findings (since after Piltdown, it was discovered that over 40 of his findings were hoaxes). But his fault of being too prideful and reputation obsessed is shared with the scientists of his country, whose similar eagerness and egotism allowed them to trust his findings without double checking everything first. I don't know what exactly caused them to make this error in judgment, but a simple test at the beginning would have shown that the teeth were filed down, or that the two fossils didn't belong together. The broad majority of scientists at this time seemed to take the word of other acclaimed scientists, spreading their agreement through word of mouth rather than through tests and retesting.

Although there was a huge blunder in Great Britain at this time because of human fault, I wouldn't want to remove the human factor from science. The humanness of this situation caused the mistake, yes, but it also caused the solution; and because we are human, we have learned from this complete oversight and it will never happen again. We're allowed to make mistakes, and I think that's the beauty in being human. Mistakes are what lead to learning, and the knowledge gained from that is invaluable. Plus, people's curiosity leads to even greater discoveries, and if we were without it, we may not learn anything new.

The real fix to this problem and the major lesson in this event is to verify everything that another person poses as fact before supporting it and including it as a part of a theory, or on a more applicable student level, before including it in any academic paper.

Comparing the Diets of Primates

A true lemur eating an orange

Most primates, including ourselves, are very similar in diet in that we are omnivores, meaning we eat both plants and other animals. We even have similar teeth that have evolved to eating a wider variety of foods than other mammals. However, coming from different environments means each species of primate has access to different sources of food, and being different species means that diets will vary just as greatly as habitats. Between prosimians, New and Old World monkeys, and lesser and great apes, one can find a great variety of dietary behaviors.

Prosimians (Strepsirhini) are found exclusively on Madagascar and the Comoro Islands. To represent this category, true lemurs (Lemuridae) spend a majority of their time in the trees of dense, tropical forests, but also spend a bit of time on the ground. Lemurs generally eat fruit and leaves that vary based on where they are in their habitat, which makes sense as they have adapted to the abundance of fruit and other plant life in their environment.

Capuchin monkeys sharing a large insect

The New World monkeys (Platyrrhini) almost exclusively dwell in the trees of forest environments, including rainforests and mountain forests, especially those of Brazil and other parts of Latin America. In particular, capuchin monkeys (Cebinae) are similar to lemurs in that they spend their time almost exclusively in trees, traversing the ground only to find water. However they differ in that they are omnivores instead of herbivores, subsisting off of flowers, fruit, other vegetation, nuts, insects and occasionally other small prey. All parts of their diet can be found throughout their habitats during the day, so they likely learned what to eat over time. Given that capuchin monkeys are very agile, they may have adapted this trait to be able to catch their prey, such as small mice, crabs, or lizards.

A baboon eating an antelope

Old World monkeys (Cercopithecidae) are extremely adaptable and inhabit a wide variety of environments in mainly Central Africa, including not only the tropical forests of New World monkeys and prosimians, but also semiarid climates of grasslands or savannas. They sleep in trees or on cliff faces for protection, and descend to forage for food. In particular, baboons (Papio) and other Old World monkeys are omnivorous like their New World cousins, except that their diet consists of much more meat since they're generally bigger in size. Baboons eat from a variety of plants, like grass, fruits, seeds, sap, leaves and the like, while also eating insects and hunting for prey such as fish, shellfish, birds, and even small mammals (i.e. hares, small antelopes, other monkeys). The environment of a baboon is generally flat savannas as well as the trees of the tropical forests in Africa, so it's a wide enough expanse to have such varied prey. Baboons have adapted to what prey and vegetation were around them; since their habitat is mainly on the ground instead of in trees, their prey would need to be as well.

A gibbon eating a fruit with its infant

The lesser apes (Hylobatidae), in particular gibbons, live in the tropical rainforests of Southeast Asia and are arboreal primates, rarely descending to the forest floor. Given that they stay mainly in the treetops, gibbons are also great at moving through the trees by swinging under branches, also known as brachiation. This adaptation allows gibbons to keep themselves safe at the top of the rainforests, not having to worry about predators that may be below. Gibbons are omnivores, and since they live high in trees, they have adapted to eat what they can find in their habitat, living off of such foods as fruits, leaves, tree bark, insects, bird eggs and small birds.

A chimpanzee eating a tropical fruit

Great apes (Hominidae), like chimpanzees (Pan troglodyte), originate almost exclusively from Africa. The natural habitat of chimpanzees includes both tropical forests and the arid savannas, similar to baboons except that chimps generally only stay in the savannas to get from one forest to the next. They are omnivores who mainly eat fruits and plants, but also eat insects, eggs, and other meat. Because they spend just as much time in trees as they do on the ground, their adaptation to different foods is a much wider range than any other primate (besides humans), and this ability allows chimps to live in much more varied environments than other primates.

The influence of the environment on primates definitely allows for the expression of behavioral dietary traits. If a monkey lives more arboreally, their diet will likely consist of more fruits and vegetation, and maybe the insects and birds that also inhabit the treetops. If a primate lives nearer to the ground, it has more options and will therefore eat more varied foods, including not only fruits and vegetation, but also animals that only tread the ground instead of the trees. The environment also plays a role in the physical traits primates develop, as in the brachiation of gibbons. Gibbons brachiate in order to go through the forest, and this quality wouldn't have lingered through evolution if they didn't have an environmental need for it. The environment stimulates natural selection in that it encourages certain physical traits and behaviors, while discouraging or even neglecting others.



Citations and Resources

African Wildlife Foundation

N.d. Baboon. African Wildlife Foundation, accessed 8 July 2014.

http://www.awf.org/wildlife-conservation/baboon.

All About Chimpanzees: Biology & Habitat.

N.d. The Jane Goodall Institute. The Jane Goodall Institute, accessed 9 July 2014.

http://www.janegoodall.org/chimpanzees/biology-habitat.

Arslan, M.

2013 Habitats Of Apes, Gibbons, Chimpanzees, Gorillas and Orang-Utans. LiveAnimalsList.com, accessed 9 July 2014.

http://www.liveanimalslist.com/mammals/habitats-of-apes.php.

Gomez, Vivian

N.d. Habitat of Capuchin Monkeys. Animals. Demand Media, accessed 9 July 2014.

http://animals.pawnation.com/habitat-capuchin-monkeys-2630.html.

Grzimek’s Animal Life Encyclopedia

2004 Lemurs (Lemuridae). Grzimek's Animal Life Encyclopedia. The Gale Group Inc., accessed 9 July 2014.

http://www.encyclopedia.com/article-1G2-3406700864/lemurs-lemuridae.html.

Janssen, Paul

N.d. Chimpanzee Facts. Out to Africa. African Wildlife Foundation, accessed 9 July 2014.

http://www.outtoafrica.nl/animals/engchimpanzee.html.

Myers, Phil

2000 Lemuridae: True Lemurs. Animal Diversity Web. University of Michigan Museum of Zoology, accessed 9 July 2014.

http://animaldiversity.ummz.umich.edu/accounts/Lemuridae/.

National Geographic

N.d. Baboon (Papio anubis). National Geographic Society, accessed 8 July 2014.

http://animals.nationalgeographic.com/animals/mammals/baboon/.

N.d. Chimpanzee (Pan troglodytes). National Geographic Society, accessed 9 July 2014. http://animals.nationalgeographic.com/animals/mammals/chimpanzee/.

N.d. Gibbon (Hylobatidae). National Geographic Society, accessed 9 July 2014.

http://animals.nationalgeographic.com/animals/mammals/gibbon/.

O'Neil, Dennis

N.d. PRIMATES: The Taxonomy and General Characteristics of Prosimians, Monkeys, Apes, and Humans. The Primates: Topic Menu. Palomar College Behavioral Sciences Department, accessed 8 July 2014.

http://anthro.palomar.edu/primate/Default.htm.

Rainforest Alliance

N.d. Capuchin Monkey (Cebus capucinus).  Rainforest Alliance, accessed 9 July 2014.

http://www.rainforest-alliance.org/kids/species-profiles/capuchin-monkey.

Rainforest Animals

2007 Lar Gibbon (Genus: Hylobates). Rainforest Animals. The Animal Spot, accessed 9 July 2014.

http://www.rainforestanimals.net/rainforestanimal/gibbon.html.

Stephens, Christina

N.d. The Average Life Span of a Lemur. Animals. Demand Media, accessed 9 July 2014.

http://animals.pawnation.com/average-life-span-lemur-4963.html.

Analogy and Homology: the Scales of Fish, Snakes, and Turtles

 Of the following three species of animals, which seem most related?

From just basic observation, all three have the common trait of scales. However from the surface one might believe that the fish and the sea turtle are most related, since they have much in common. They both spend a majority (if not all) of their lives in the sea, have scales, and have limbs for locomotion in water (fins and flippers), while a snake has only scales.

But just because two species share this trait does not mean they are closely related; maybe distantly so, but they are actually analogous in comparison. Both fish and sea turtles have scales for protection, and sometimes for camouflage, but that's essentially where the similarities end. If we go far enough back in evolution, all animals evolved from fish, so their common ancestor is more than likely another fish than a reptile. This common ancestor probably did share this analogous trait, given that even ancient fish would need to protect themselves from the elements and other predators, so when fish evolved into tetrapods, then to amphibians, and even later still reptiles, this is an evolutionarily beneficial quality they passed down through the generations, disappearing in the amphibian stage and reappearing in the reptiles that followed.

For snakes and sea turtles however, the connection is much more closely related, given that they are both reptiles and thus came from a common genetic relationship. The composition of their scales differs in that the scales of a snake have a sort of waxy layer that allows snakes to be away from water, whereas the scales on the shells of turtles are much drier in comparison. Also, scales for a snake are constructed as part of its skin, much like a fish, while turtles have scutes, which are much more like plates on its shell. And while sea turtles are equipped from the structure of their shells to live most of their lives underwater, most snakes cannot do the same. Both snakes and sea turtles have seemingly more in common with the scales of fish than with each other, but they are homologous nonetheless. 

Citations and Resources

Caldwell, Michelle

N.d. Reptile and Amphibian Evolution. Reptile and Amphibian Evolution. University of Michigan Museum of Zoology, accessed 03 July 2014. http://www.michellecaldwell.com/linkfiles/scaredcricket/articles/other/evolution.html.

Hall, Brook Ellen

2002 Animal Sciences: Scales, Feathers, and Hair. Encyclopedia.com. HighBeam Research, accessed July 2014.

http://www.encyclopedia.com/doc/1G2-3400500293.html.

S., Gauri, Kate T., Pooja Sehgal, Nikhilesh Jasuja, and Rupal Bansal.

N.d. Amphibian vs. Reptile. Diffen.com. Diffen LLC, accessed 03 July 2014. http://www.diffen.com/difference/Amphibian_vs_Reptile#Evolution_of_Reptiles_and_Amphibians.

Strauss, Bob

N.d. The Evolution of Vertebrates, in 10 (Not So Easy) Steps. About.com Dinosaurs. About.com, accessed 03 July 2014. http://dinosaurs.about.com/od/otherprehistoriclife/tp/Vertebrate-Animal-Evolution.htm.

Trimarchi, Maria

2008 Can a Turtle Outgrow Its Shell? HowStuffWorks.com. InfoSpace LLC, accessed 03 July 2014.

http://animals.howstuffworks.com/reptiles/turtle-shell1.htm.

Protein Synthesis: Alternative Codon Code

Best of luck! :)

CTCCAGTACTAAGGCTTGAACGCAGCCAGTGCTATGTCAATCTCAGT

Thomas Malthus as an Historical Influence on Charles Darwin

            Thomas Malthus was an English economist who was and is still known for his studies, writings and theories about overpopulation and population growth in general. He theorized that, if unchecked, humans would continue overpopulating the earth until all of the world’s resources were used up, leaving people with no way of feeding themselves. According to the University of California Museum of Paleontology (UCMP), “[Malthus] blamed this decline [of living conditions] on three elements: The overproduction of young; the inability of resources to keep up with the rising human population; and the irresponsibility of the lower classes” (UCMP 1995). The first two causes were reasonable and potentially could have been falsifiable, and even Charles Darwin hadn’t broached this concept.

            After reading Malthus’s Essay on the Principle of Population (1798) Darwin notes in his autobiography, “It at once struck me that under these circumstances favourable variations would tend to be preserved, and unfavourable ones to be destroyed. The results of this would be the formation of a new species. Here, then I had at last got a theory by which to work” (UCMP 1995). Malthus’s essay gave Darwin a new mode of thinking about his own theory, and without it, The Origin of Species would not have been as successful a body of work. Prior to reading it, “Darwin had thought that living things reproduced just enough individuals to keep populations stable,” but through Malthus realized that organisms grow exponentially to encourage and support the survival of their species; the strongest and best adapted survive, while the weakest perish and their genes do not get passed on (Darwin and Malthus 2001).

            Darwin’s realization relates directly to the points: 1) All organisms have the potential of reproducing exponentially, and 2) Resources are limited. Without these two points, Darwin’s theory would really have no basis on which to stand. By understanding that overpopulation is possible for every living being, he then understood that a lack of resources creates competition between offspring and between species themselves; so whichever creatures were best suited for their environment through physical adaptations over time would be more likely to survive. Without Malthus’s essay on these very topics, even though they were related to economics and the human population, Darwin’s theory would not have been nearly as correct, as the point of overpopulation is fundamental to evolution and natural selection. Darwin was able to build off of Thomas Malthus’s work to create a more accurate representation of how natural selection worked.

            This isn’t to say that Darwin would have been completely unable to do this himself, but it would have taken him much longer. He hadn’t previously thought of overpopulation as a necessary step of evolution, so Malthus’s work greatly influenced Darwin’s course.
            The attitude of the church, however, further limited Darwin at this time, because they, like Malthus, were still under the impression that everything that occurred in the world had some divine intercession behind it. Not only did this limit their breadth of knowledge, it also limited what knowledge could be shared. Although Malthus correctly saw some of the effects of overpopulation, he still believed that famine and poverty were from the will of God to prevent man’s laziness (UCMP 1995), instead of just attributing it to a lack of resources as he had already posed. Every theory at this time was expected to respect divine influence, giving all credit to God instead of trying to find a natural explanation on Earth, so it’s really no wonder why it took Darwin over 20 years to publish On the Origin of Species. Given his family’s position in society, and his level of regard in the scientific community, breaking away from the fairly oppressive beliefs of the church are what hindered his publication. But, to bring this subject full circle, without Malthus’s ideas, the book might never have been finished.

Citations and Resources

BBC News

N.d. Thomas Malthus (1766 – 1834). BBC News. BBC, accessed 17 June 2014. http://www.bbc.co.uk/history/historic_figures/malthus_thomas.shtml.

Darwin and Malthus

2001 WGBH Educational Foundation and Clear Blue Sky Productions, Inc. Evolution by Public Broadcasting Service (PBS), accessed 17 June 2014. http://www.pbs.org/wgbh/evolution/library/02/5/l_025_01.html.

MacRae, Donald Gunn

N.d. Malthusian Theory. Encyclopedia Britannica Online. Encyclopedia Britannica, accessed 17 June 2014.

http://www.britannica.com/EBchecked/topic/360609/Thomas-Robert-Malthus/222944/Malthusian-theory.

University of California Museum of Paleontology

1995 Thomas Malthus (1766-1834). UCMP, accessed 17 June 2014. http://www.ucmp.berkeley.edu/history/malthus.html.